Finance

. For I = TTGGAATACCATC and J = GGCATAATGCACCCC , make dot matrices for the k -tuple hits for k = 1,

. For
I = TTGGAATACCATC and J = GGCATAATGCACCCC, make dot

Don't use plagiarized sources. Get Your Custom Essay on
. For I = TTGGAATACCATC and J = GGCATAATGCACCCC , make dot matrices for the k -tuple hits for k = 1,
Just from $13/Page
Order Essay

matrices for the k-tuple hits for k = 1, 2, and 3.

 

. The
E. coli F plasmid transfer
origin region contains the sequence

I:

5_-ATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTT

AAAAAAGCG-3_

The TraY protein has been shown to
bind to a region some 1600 bp away at

a site that contains the sequence

J:

5_-TAACACCTCCCGCTGTTTAT-3_

Perform dot-matrix analyses for k
= 1 and k = 2 to locate in I a subsequence

that is similar to J. This
identifies a potential binding site for TraY in sequence

I. [Hint: Use R to construct a
matrix having dimensions determined

by the lengths of J and I,
initialize elements to zero, and then substitute the

appropriate elements with the
number 1 to indicate matches. Produce two

matrices: one for k = 1 and
another for k = 2.]

 

Related Articles

Back to top button

Order your essay today and save 30% with the discount code ESSAYHELP